PART 1
1. This experiment proved to be very difficult - especially since it was conducted with friends. The first part where I had to refrain from speaking at all was challenging. Being among friends, communication is very important; it is how you maintain your relationship. I found myself struggling not to blurt out my view and join the conversation. However, the second part was much harder. Once you concentrate on doing nothing but speaking, you really become aware of how much more is involved in communicating than just talking. Trying to cut off any other cues such as body language, facial expressions, and even the curbing of tone is very difficult.
2. I didn't tell my friends about the experiment until after I was done. During the first part when I wasn't speaking, they asked me what was wrong and if I was ok. Just shaking my head in assurance that I was fine and smiling in response didn't convince them I was completely fine [especially since I'm normally a talker]. My monotone voice in the second part had a more negative response because this time I had a tone of indifference. Communication with me dwindled a little because I didn't seem to be emotionally involved and gave the impression of being upset.
3. I think the culture who uses symbolic communication has more of an advantage of communicating complex ideas because symbolic language is more complex than using nothing but just a voice. People communicate far more with their tone, expressions, and body language than with just their words. The speaking culture would most likely be wary of the culture who does not use symbolic language because they would not be able to read the non-speaking culture very well. Also, there would probably be a lack of in-depth understanding because like I said, the way we say things and the gestures that go along with them are full of ten times more info than just our words.
People who cannot speak at all have difficulty with spoken language. They have ways of communicating with writing and sign languages but most people who can speak don't fully understand. Different languages use different tones, and when two people who have spoken different languages their whole life meet, there has to be a bit of discrepancy in their communication.
PART 2
1. I caved on each half of the experiment about ten minutes in. It was necessarily because I couldn't do it or that I was afraid I was making my friends mad or worried, it was because not speaking when I wanted to and taking part in the conversations "normally" made me feel like an outsider. Cutting myself off from communicating with my friends in an in-depth manner made me feel cut off.
2. Once I told my friends what the experiment was, they just laughed it off, but they told me how they felt about it. First off, they felt as though something was wrong - because I'm usually always talking - and for some reason I wasn't today [that's something I do when I'm upset or stressed]. Knowing that, they took my silence as a sign of distress from me and despite my smiles and shaking my head in answer that I was ok, they didn't believe me fully. When I was talking, but using a mono-tone voice, they really thought something was wrong. They said I seemed completely indifferent and it was frustrating because even though I said I was fine, my tone and body language said something else. Not using verbal cues and body language really threw them off.
3. The use of "signs" in our language is extremely important. It portrays how we're really feeling and allows people to understand what we mean or feel more in-depth. Tone hints at mood and so does body language. When there is no use of it, we assume anger or indifference. Wires get crossed when we can't figure out what another person is thinking which makes us upset. Also, by listening to a person and watching them, we learn more about them than what they tell us. We learn about how they feel about certain things, what they like, dislike, etc.
4. Yes, some people don't fully understand body language. They don't get the usual cues someone else might take as a signal to leave them alone, or that they don't like something. The adaptive benefit of reading body language is that we can recognize how to make people happy, recognize when people are sad and try and help them, all things that bring people closer. Also, with being able to use symbolic language we can recognize when certain people are threats or lying and to stay away from those people who could cause us damage emotionally or physically. Body language is so useful all over the world, and benefits us in every aspect of our lives, that not reading body language doesn't seem beneficial anywhere. Not reading body language would cut us off from people, which we need for the sake of our emotional well-being. With that, I don't think there is an environment where not reading body language is a benefit.
Tuesday, November 29, 2011
Tuesday, November 15, 2011
The Piltdown Hoax
1. THE PILTDOWN HOAX
The Piltdown Hoax took place in 1912 where remains found by Charles Dawson at an archaeological site in Piltdown, England were thought to be part of what we now know as the "Missing Link." The creature they found had features that were comparable to the skull of a human and the jaw of an ape. A lot of people in the scientific community were skeptical with most saying the bones resembled parts of different animals rather than just one. The press, public, and most of the scientific community accepted the hoax as real at first though. The fact that Darwin's theory of evolution was a popular new hot topic had people interested in anything having to do with it. Many people went wild, feeling as though they had finally found the link that proved his theories right.
In 1953, however, Kenneth Page Oakley, Sir Wilfred Edward Le Gros Clark, and Joseph Weiner proved the Piltdown Man as a hoax. The technology of carbon dating recently developed in the 40s allowed a way to test the bones, revealing them to be much younger than believed for so many years. Further examination revealed file marks on the teeth revealing that the teeth had been filed down to appear as a human's.
In the fields of human evolution, the Piltdown hoax was a shameful one. It led scientists into wrong beliefs about brain size compared to jaw size. If the Piltdown hoax were true, it would have been evidence of the human brain expanding before the jaw was able to adapt to new foods. In addition, science took a huge hit from non-believing communities as well. The Piltdown hoax fueled the fires that skeptics of science harbored.
2. FAULTS IN THE PILTDOWN HOAX:
I think haste is the biggest fault that comes into play when it comes to the Piltdown hoax. Scientists were in the midst of a hot topic and eager to figure out its mysteries. Evolution was - and still is today - an extremely controversial concept. However, when the Piltdown Hoax took place, evolution was a fairly new concept proviking skepticism and making people all the more eager to have a solid answer about its legitimacy. The fact that there was a lack of technology to uncover the truth about the hoax, plus a rather premature concept of how evolution works, and a drive to figure it out, were all faults of the people believing the hoax and part of the reason why scientists did not recognize sooner what was really going on. The scientific process was hindered through these faults because scientists were led on a wrong path. False concepts about evolution were considered because of false evidence that was found.
3. SCIENTIFIC PROCESSES TO REVEAL THE HOAX
The Piltdown skull was revealed as a fraud through several methods. First, with a breakthrough in carbon dating of fossils, the skull was dated to be much younger that originally believed. Also, when placed under a microscope, file-marks were found on the teeth; the teeth seemed to have been ground down to resemble the wear patterns on human teeth. Lastly, with the fact that the skull had been dated to medieval times, scientists reasoned that to create wear similar to that of what would have been produced from the area in Piltdown, the skull had been boiled and stained with an iron solution and chromic acid.
Scientists had always been skeptics about the skull - especially since other fossils found didn't fit the same bill as the Piltdown skull. Scientists felt that compared to other fossils, the skull was inconsistent with the development of humans.
4. THE HUMAN FACTOR
I don't think it is possible to remove the human factor - part of being human is the human factor. The human factor is not only our ability to be at fault, but our ability to feel and reason We feel curious, and reason to solve our questions which can end up in fault. However, being at fault isn't necessarily a bad thing. To be wrong is just as much a way of learning as being right.
Overall, I would not want to remove the human factor. It's because we're human and alive that we're so curious. To take that away and be right all the time would be boring. The chase for answers and the wrong routes we take to get there are just as, if not more, beneficial as all of the right routes; not to mention it is just as enticing as the truth it leads to.
5. LESSONS LEARNED
Taking any information at face value is never a good idea. Everyone believes something different and most often people are under the impression that what they believe is right. If someone was to accept everything they heard without checking it for themselves first could collect a whole lot of useless information.
The Piltdown Hoax took place in 1912 where remains found by Charles Dawson at an archaeological site in Piltdown, England were thought to be part of what we now know as the "Missing Link." The creature they found had features that were comparable to the skull of a human and the jaw of an ape. A lot of people in the scientific community were skeptical with most saying the bones resembled parts of different animals rather than just one. The press, public, and most of the scientific community accepted the hoax as real at first though. The fact that Darwin's theory of evolution was a popular new hot topic had people interested in anything having to do with it. Many people went wild, feeling as though they had finally found the link that proved his theories right.
In 1953, however, Kenneth Page Oakley, Sir Wilfred Edward Le Gros Clark, and Joseph Weiner proved the Piltdown Man as a hoax. The technology of carbon dating recently developed in the 40s allowed a way to test the bones, revealing them to be much younger than believed for so many years. Further examination revealed file marks on the teeth revealing that the teeth had been filed down to appear as a human's.
In the fields of human evolution, the Piltdown hoax was a shameful one. It led scientists into wrong beliefs about brain size compared to jaw size. If the Piltdown hoax were true, it would have been evidence of the human brain expanding before the jaw was able to adapt to new foods. In addition, science took a huge hit from non-believing communities as well. The Piltdown hoax fueled the fires that skeptics of science harbored.
2. FAULTS IN THE PILTDOWN HOAX:
I think haste is the biggest fault that comes into play when it comes to the Piltdown hoax. Scientists were in the midst of a hot topic and eager to figure out its mysteries. Evolution was - and still is today - an extremely controversial concept. However, when the Piltdown Hoax took place, evolution was a fairly new concept proviking skepticism and making people all the more eager to have a solid answer about its legitimacy. The fact that there was a lack of technology to uncover the truth about the hoax, plus a rather premature concept of how evolution works, and a drive to figure it out, were all faults of the people believing the hoax and part of the reason why scientists did not recognize sooner what was really going on. The scientific process was hindered through these faults because scientists were led on a wrong path. False concepts about evolution were considered because of false evidence that was found.
3. SCIENTIFIC PROCESSES TO REVEAL THE HOAX
The Piltdown skull was revealed as a fraud through several methods. First, with a breakthrough in carbon dating of fossils, the skull was dated to be much younger that originally believed. Also, when placed under a microscope, file-marks were found on the teeth; the teeth seemed to have been ground down to resemble the wear patterns on human teeth. Lastly, with the fact that the skull had been dated to medieval times, scientists reasoned that to create wear similar to that of what would have been produced from the area in Piltdown, the skull had been boiled and stained with an iron solution and chromic acid.
Scientists had always been skeptics about the skull - especially since other fossils found didn't fit the same bill as the Piltdown skull. Scientists felt that compared to other fossils, the skull was inconsistent with the development of humans.
4. THE HUMAN FACTOR
I don't think it is possible to remove the human factor - part of being human is the human factor. The human factor is not only our ability to be at fault, but our ability to feel and reason We feel curious, and reason to solve our questions which can end up in fault. However, being at fault isn't necessarily a bad thing. To be wrong is just as much a way of learning as being right.
Overall, I would not want to remove the human factor. It's because we're human and alive that we're so curious. To take that away and be right all the time would be boring. The chase for answers and the wrong routes we take to get there are just as, if not more, beneficial as all of the right routes; not to mention it is just as enticing as the truth it leads to.
5. LESSONS LEARNED
Taking any information at face value is never a good idea. Everyone believes something different and most often people are under the impression that what they believe is right. If someone was to accept everything they heard without checking it for themselves first could collect a whole lot of useless information.
Wednesday, November 9, 2011
Week 3 - Dentition Pattern
Week 3: Dentition Patterns
Ring Tailed Lemur:
1. ENVIRONMENT: Ring tailed lemurs generally live in dry environments or the highland areas of Madagascar. Dry environments include scrub that are plateau-like areas consisting mainly of shrubs and grasses and gallery forests that are evergreen forests which grow on the sides of river banks in otherwise dry areas such as deserts and grasslands. Lemurs live in the highlands of Madagascar in Montane forests, which are also called cloud forests, and look like something straight out of Jurassic park. They are in a nearly constant cover of clouds with moss being the most common plant.
2. DENTITION PATTERN: Ring-tailed lemurs have a dentition pattern of
2.1.3.3
2.1.3.3 which means they have 2 incisors, 1 canine, 3 premolars, and 3 molars totaling 36 permanent teeth compared to their deciduous dentition of only 24 teeth [lacking last 3 molars]. The 4 incisors and 2 canines of the lower jaw stick out facing more horizontal than vertical creating a tooth comb used for grooming and eating.
3. TRAIT ADAPTION: Lemurs eat fruits, leaves, small insects, nuts, and even tree sap. The tooth comb allows for a shearing effect that is beneficial when eating leaves of scraping sap off of trees. Also, the small incisors of the tooth comb would be beneficial for opening small nuts or insects allowing the animal to scrape out the edible parts. Molars in the back of the mouth are good for grinding what would probably make up most of the lemurs diet – leaves – whereas the canines that lemurs do possess would be good to get into an insects tough shell or get into any other small vertebrate it found.
4. PICTURE:
Ring-tailed lemur: a.k.a “sun worshipers”
Toothcomb
White-Fronted Spider Monkey:
1. ENVIRONMENT: Spider monkeys generally live in the tropical forests of central and south America from about Mexico to Brazil. They live in the upper layers of rainforests roaming about 82 to 95ft up.
2. DENTITION PATTERN: Spider monkeys have a dental formula of
2.1.3.3
2.1.3.3 meaning they have 2 incisors, 1 canine, 3 premolars, and 3 molars. They have large incisors and small molars hinting to diet centered more towards fruits and small insects. They have cusps on all of their molars indicating the molars can be used for incising as well.
3. TRAIT ADAPTION: Living in the forest, leaves would be the most abundant food around. Molars are essential to the grinding down of leaves and other plants. Incisors, and sharp molars that spider monkeys have, however, were adopted so as to take full advantage of the other beneficial foods in the forest such as small insects and fruits in which case they would need a set of teeth that could break through the skin of fruits and shells of insects.
4. PICTURE:
MANDRILL BABOON:
1. ENVIRONMENT: Baboons, particularly the Mandrill, likes to live in tropical rainforests, but drier climates such as gallery forests with savannas and open grassland.
2. DENTITION PATTERN: Baboons, as is with all old-world monkeys, have the same dental pattern as humans with the formula being
2.1.2.3
2.1.2.3 meaning we have 2 incisors, 1 canine, 2 premolars, and 3 molars. This is in contrast with new world monkeys who have 3 premolars and 2 or 3 molars.
3. TRAIT ADAPTION: Baboons have a dental formula signifying they have a varied diet like most primates. Grasslands and forests offer vegetation as a source of food, which could be easily ground down with premolars and molars, but baboons are omnivores. Incisors and canines would have been developed in order to take advantage of other food sources such as fruits, insects, and small animals.
4. PICTURE:
GIBBON:
1. ENVIRONMENT: Gibbons enjoy the thick rainforests of South East Asia which are either deciduous or evergreen. They rarely come down to the floor, living their lives entirely up in the trees.
2. DENTITION PATTERN: Gibbons have a dental formula of
2.1.2.3
2.1.2.3 like old world monkeys and great apes. They have 2 incisors, 1 canine, 2 premolars, and 3 molars.
3. TRAIT ADAPTION: Gibbon teeth are adapted for a varied diet. They enjoy fruit, leaves, insects, and small animals. Molars would have developed as a way to grind down vegetation whereas incisors and molars would have been developed to cut through meat and fruit allowing the gibbon to adopt a more beneficial omnivorous diet.
CHIMPANZEE:
1. ENVIRONMENT: Chimpanzees enjoy the rainforests and wet savannas of Africa. They spend equal time on land and trees but mostly feed and sleep in trees.
2. DENTITION PATTERN: Chimps, like humans, have a dental formula of
2.1.2.3
2.1.2.3. This indicates that they have a broad, omnivorous diet. They have broad incisors, with their upper molars being quadrate and bunodont and their lower molars being bunodont and possess a hypoconulid.
3. Being omnivores, chimps need molars for grinding and incisors and canines in order to eat other things such as small animals. Having a diet that is mainly fruit, plant, and insect based, chimps needed to have adapted a set of teeth that would benefit them and allow them to take advantage of the beneficial food sources their home provided.
4. PICTURE:
ENVIRONMENTAL INFLUENCE ON EXPRESSION OF PHYSICAL AND BEHAVIORAL TRAITS:
PHYSICAL TRAITS:
All of the monkeys listed above have omnivorous diets, prompting evolution of equip them with a set of teeth allowing for multiple purposes. Their environments – mostly forests and svannas – where not only grass, but small animals, fruits, and insects allow for a more beneficial and full diet. Teeth such molars allow for the grinding of food, but they do not allow for the cutting or scraping of it. Traits such as tooth combs and canines allow the animals to more easily consume process the foods around them ultimately allowing for a more varied and healthy diet.
Friday, November 4, 2011
Thursday, November 3, 2011
Homologous/Analogous Animals
1. a) Sharks and manta rays are homologous species that both have fins, gills, and scales.
b) Fins:
Shark fins are rigid, and fairly independent, structures protruding from their body that are made
for speed. A manta ray's fins are completely attached to their body making them look like one
solid fin that are made for cruising.
Gills:
Sharks most often have five gills slits that are used to collect oxygen from the water as it passes
through them and transferred to throughout the body. A manta ray has five gill slits as well, but
besides gathering oxygen, they are used to collect plankton and other organisms on gill rakers
between the gill slats.
Scales:
Scales are a homologous trait between sharks and manta rays as well with both animals having
placoid scales as their armor. A manta ray has a thicker coating on their skin, making them softer
to the touch, but sharks feel like sand paper and have scales that turn or "bristle" to reduce drag
in the water.
c)A common ancestor of sharks and rays is hard, if not impossible because they belong to the phylum
chondrichthyes (cartilaginous fish). Cartilage does not keep the way bone does making fossils and
records virtually impossible to find - especially thousands and millions of years in the past.
d)
2. a) Sharks and whales can look very similar from far away, and both have fins, but they are
analogous animals. Sharks have gills, a cartilage skeleton, scales, and a vertical tail fin. Whales
have skin, horizontal tail fins, a skeleton of bone, and have to go to the surface for air.
b) Fins:
The fins of a shark are analogous to a whales because they do no move. Sharks mainly use
their tails to swim where whales are more capable of moving their fins up down, side to side to
act as a rudder. Also, a shark has a vertical tail fin that they move from side to side to swim
through the water. A whale has a horizontal tail fin that moves up and down to propel them.
Breathing:
Sharks use gills to collect oxygen from the water whereas whales have an opening atop their
head that closes to keep water out and hold their breath when they are under the water and
opens when they come to the surface to breath.
Skin:
Sharks have skin made of microscopic scales. It serves as body armor against other predators.
Whales have actual skin with glands and hair and all like all other mammals.
c) When looking through cladograms, I noticed that sharks had become their own class and evolving
independently from mammals millions of years before mammals even developed. With this
information [about the only information I could find] I would say that a common ancestor of
sharks and whales was some type of shark of fish.
d)
b) Fins:
Shark fins are rigid, and fairly independent, structures protruding from their body that are made
for speed. A manta ray's fins are completely attached to their body making them look like one
solid fin that are made for cruising.
Gills:
Sharks most often have five gills slits that are used to collect oxygen from the water as it passes
through them and transferred to throughout the body. A manta ray has five gill slits as well, but
besides gathering oxygen, they are used to collect plankton and other organisms on gill rakers
between the gill slats.
Scales:
Scales are a homologous trait between sharks and manta rays as well with both animals having
placoid scales as their armor. A manta ray has a thicker coating on their skin, making them softer
to the touch, but sharks feel like sand paper and have scales that turn or "bristle" to reduce drag
in the water.
c)A common ancestor of sharks and rays is hard, if not impossible because they belong to the phylum
chondrichthyes (cartilaginous fish). Cartilage does not keep the way bone does making fossils and
records virtually impossible to find - especially thousands and millions of years in the past.
d)
2. a) Sharks and whales can look very similar from far away, and both have fins, but they are
analogous animals. Sharks have gills, a cartilage skeleton, scales, and a vertical tail fin. Whales
have skin, horizontal tail fins, a skeleton of bone, and have to go to the surface for air.
b) Fins:
The fins of a shark are analogous to a whales because they do no move. Sharks mainly use
their tails to swim where whales are more capable of moving their fins up down, side to side to
act as a rudder. Also, a shark has a vertical tail fin that they move from side to side to swim
through the water. A whale has a horizontal tail fin that moves up and down to propel them.
Breathing:
Sharks use gills to collect oxygen from the water whereas whales have an opening atop their
head that closes to keep water out and hold their breath when they are under the water and
opens when they come to the surface to breath.
Skin:
Sharks have skin made of microscopic scales. It serves as body armor against other predators.
Whales have actual skin with glands and hair and all like all other mammals.
c) When looking through cladograms, I noticed that sharks had become their own class and evolving
independently from mammals millions of years before mammals even developed. With this
information [about the only information I could find] I would say that a common ancestor of
sharks and whales was some type of shark of fish.
d)
Wednesday, October 26, 2011
Protein Synthesis Assignment
Here's a mind-boggler!!
DNA Sentence:
CCTTACACCCTCTGGGTTATATTGAGTGCTAAAATTCTGTTTATCGCG
DNA Sentence:
CCTTACACCCTCTGGGTTATATTGAGTGCTAAAATTCTGTTTATCGCG
Saturday, October 22, 2011
Darwin and His Influences
1. I think that Charles Lyell had the most influence on Charles Darwin for two reasons. First of all, Lyell’s own research on coral reef formation inspired Darwin to start his own. Lyell had published a book that Darwin eventual came into contact with and found intriguing and impressive. Darwin then, several years after reading Lyell’s research, decided to collect data of his own on coral reef formations that were later proved in the 1950s. Had it not been for Lyell, Darwin would probably have either not started and interest in evolution or gotten a late start. Secondly, Lyell encouraged Darwin to go further with his research and publish his ideas. Who knows, without Lyell, Darwin and his ideas could have stayed a mystery until found in a dusty attic some hundred years later!
http://www.aboutdarwin.com/people/people_01.html#0140
2. Lyell’s major scientific contribution was the “Principles of Geology” in which he concluded that the Earth was formed in slow, progressive changes rather than fast like in Cuvier’s catastrophism theory that proposed that Earth formed in sudden violent events. Lyell proposed [and was later proved right] that Earth was subject to the same type of geological forces now that it was in the past including: erosion, earthquakes, glaciers, volcanoes, and decay of the landscape and inhabitants on Earth.
http://anthro.palomar.edu/evolve/evolve_1.htm
3. I believe the point that “if an environment changes, the traits that are helpful or adaptive to that environment will be different..” To me, this point corresponds with Lyell’s work on the evolution of Earth and her features. Again, Darwin was inspired by Lyell’s work and decided to do research of his own. Upon researching, Darwin, who probably already had ideas of his own about the wild life living within the ever changing coral reefs, at one point decided to research the similarities between different species and improve upon his then hypotheses on evolution. Also, the fact that Darwin researched the ever changing Earth could made Darwin curious about how the organisms and life survived in a different environment over thousands and millions of years.
4. Yes, I believe that Darwin needs his background work in the evolution of geology to complete his work on natural selection. The fact that the Earth is always changing means that food sources and availability is constantly changing. In order to survive, animals must be able to reach these food sources and thus constantly changing. Natural selection allows for the advancement and survival of the organisms best suited to survive in the constantly changing environments.
5. The church in Darwin’s time slowed him down but did not stop him. At that time it was not common practice to look to science to explain the wonders of the world or to provide answers about the life on Earth. He was afraid of being attacked by the church for his ideas and thus hesitant to publish his work. Eventually, he decided to publish his research and he was right – it was greatly frowned upon and attacked by the church.
Subscribe to:
Posts (Atom)











