Here's a mind-boggler!!
DNA Sentence:
CCTTACACCCTCTGGGTTATATTGAGTGCTAAAATTCTGTTTATCGCG
Wednesday, October 26, 2011
Saturday, October 22, 2011
Darwin and His Influences
1. I think that Charles Lyell had the most influence on Charles Darwin for two reasons. First of all, Lyell’s own research on coral reef formation inspired Darwin to start his own. Lyell had published a book that Darwin eventual came into contact with and found intriguing and impressive. Darwin then, several years after reading Lyell’s research, decided to collect data of his own on coral reef formations that were later proved in the 1950s. Had it not been for Lyell, Darwin would probably have either not started and interest in evolution or gotten a late start. Secondly, Lyell encouraged Darwin to go further with his research and publish his ideas. Who knows, without Lyell, Darwin and his ideas could have stayed a mystery until found in a dusty attic some hundred years later!
http://www.aboutdarwin.com/people/people_01.html#0140
2. Lyell’s major scientific contribution was the “Principles of Geology” in which he concluded that the Earth was formed in slow, progressive changes rather than fast like in Cuvier’s catastrophism theory that proposed that Earth formed in sudden violent events. Lyell proposed [and was later proved right] that Earth was subject to the same type of geological forces now that it was in the past including: erosion, earthquakes, glaciers, volcanoes, and decay of the landscape and inhabitants on Earth.
http://anthro.palomar.edu/evolve/evolve_1.htm
3. I believe the point that “if an environment changes, the traits that are helpful or adaptive to that environment will be different..” To me, this point corresponds with Lyell’s work on the evolution of Earth and her features. Again, Darwin was inspired by Lyell’s work and decided to do research of his own. Upon researching, Darwin, who probably already had ideas of his own about the wild life living within the ever changing coral reefs, at one point decided to research the similarities between different species and improve upon his then hypotheses on evolution. Also, the fact that Darwin researched the ever changing Earth could made Darwin curious about how the organisms and life survived in a different environment over thousands and millions of years.
4. Yes, I believe that Darwin needs his background work in the evolution of geology to complete his work on natural selection. The fact that the Earth is always changing means that food sources and availability is constantly changing. In order to survive, animals must be able to reach these food sources and thus constantly changing. Natural selection allows for the advancement and survival of the organisms best suited to survive in the constantly changing environments.
5. The church in Darwin’s time slowed him down but did not stop him. At that time it was not common practice to look to science to explain the wonders of the world or to provide answers about the life on Earth. He was afraid of being attacked by the church for his ideas and thus hesitant to publish his work. Eventually, he decided to publish his research and he was right – it was greatly frowned upon and attacked by the church.
Tuesday, October 18, 2011
Really excited to blog!
Testing out this new blog spot! I've never done this before and am really excited to try!
Subscribe to:
Comments (Atom)